View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2149_high_3 (Length: 230)
Name: NF2149_high_3
Description: NF2149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2149_high_3 |
 |  |
|
| [»] scaffold0391 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0391 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: scaffold0391
Description:
Target: scaffold0391; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 17 - 214
Target Start/End: Original strand, 5334 - 5532
Alignment:
| Q |
17 |
attctatgacagtagtgggtataaaaggaagaaatgcgcttacgatatcaaggnnnnnnnnnnnnnnnnn-ctgtgtttaaaagatcacacatgtgatat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5334 |
attctatgacagtagtgggtataaaaggaagaaatgcgcttacgatatcaaggttttttcttttttcttttctgtgtttaaaagatcacacatgtgatat |
5433 |
T |
 |
| Q |
116 |
aaagataatgtatgagactttacactcatattcaatttaacagggagacaattctaatttgtaaaacaccggatgcaacggctgtaaccagccaaaaac |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5434 |
aaagataatgtatgagactttacactcatattcaatttaacagggagacaattctaatttgtaaaacaccggatgcaacggctgtaaccagccaaaaac |
5532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University