View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21504_low_7 (Length: 273)
Name: NF21504_low_7
Description: NF21504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21504_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 10 - 254
Target Start/End: Original strand, 38624995 - 38625239
Alignment:
| Q |
10 |
gcacagagaatgtagatgaatatcatgaatgcaagtgaggtgtcagaggccaaggaccnnnnnnntcacatatcagaatgctatcaaatctcaatttaaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
38624995 |
gcacagagaatgtagatgaatatcatgaatgcaagtgaggtgtcagaggccaaggaccaaaaaaatcacatatcagaatgctatcaaatctcagtttaaa |
38625094 |
T |
 |
| Q |
110 |
tttttatatttgaagtgatcgtgtcaatatattcttccctttcggggatgccgctgtaattggagaacggatggatcagaaatctgaaaatcatctcttc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38625095 |
tttttatatttgaagtgatcgtgtcaatatattcttccctttcggggatgccgctgtaattggagaacggatggatcagaaatctgaaaatcatctcttc |
38625194 |
T |
 |
| Q |
210 |
caccaatctggtattttaagcctttggctcctatgaactgattgt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38625195 |
caccaatctggtattttaagcctttggctcctatgaactgattgt |
38625239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University