View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21505_high_13 (Length: 238)
Name: NF21505_high_13
Description: NF21505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21505_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 45016341 - 45016559
Alignment:
| Q |
1 |
aataaattatataactataattgaaattctagtacatggatacataagaagatgttt-ttaacgtacatgagtttctaagatcccatacatcataaacaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
45016341 |
aataaattatataactataattgaaattctactacatggatacataagaagatgttaattaacgtacatgagttcctacgatcccatacatcataaacaa |
45016440 |
T |
 |
| Q |
100 |
tggggatttgatttactcttaatatttagtcctttctttcatcatatataaatgcctctacaataaaactcatatattaacttaattaatattgttttac |
199 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45016441 |
tggggatttgatttactct-aatatttagtcctttctttcatcatatataaatgcctctacaataaaactcatatattaacttaattaatattgttttac |
45016539 |
T |
 |
| Q |
200 |
atagaggatgcatgcatata |
219 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45016540 |
atagaggatgcatgcatata |
45016559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University