View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21505_high_9 (Length: 323)
Name: NF21505_high_9
Description: NF21505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21505_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 310
Target Start/End: Complemental strand, 35032592 - 35032283
Alignment:
| Q |
1 |
catattattggatcgatttcatctatctcgtgatagaatcatagaagttcaaattatggttaatgattgaaacaaaactnnnnnnntcaagcatcaaatg |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35032592 |
catattattagatcgatttcatctatctcgtgatagaatcataaaagtccaaattatggttaatgattgaaacaaaactaaaaaaatcaagcatcaaatg |
35032493 |
T |
|
| Q |
101 |
tactttgttttattttatattttatgaagnnnnnnngtgcactttattttttagttgtcaatgaccccaaacccaaagcttcaatgacatttaaattcta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35032492 |
tactttgttttattttatattttatgaagaaaaaaagtgcactttattttttagttgtcaatgaccccaaacccaaagcttcaatgacatttaaattcta |
35032393 |
T |
|
| Q |
201 |
tgttcgccatttcttgctacagcaaacacaaaattatcaacatcttcctaaagtagatcaggggaatagtatatattccatgagcacaaagctttcactc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35032392 |
tgttcgccatttcttgctacagcaaacacaaaattatcaacatcttcctaaagtagatcaggggaatagtatatattccatgagcacaaagctttcactc |
35032293 |
T |
|
| Q |
301 |
atatcttttc |
310 |
Q |
| |
|
|||||||||| |
|
|
| T |
35032292 |
atatcttttc |
35032283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University