View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21505_low_15 (Length: 227)
Name: NF21505_low_15
Description: NF21505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21505_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 30 - 215
Target Start/End: Complemental strand, 41847143 - 41846952
Alignment:
| Q |
30 |
gtgcattttgttggtattagaagtgctaatcaattccttttagctatcgttagctaaatatctcattcccatcagaacttttaacaatctttaattaaac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41847143 |
gtgcattttgttggtattagaagtgctaatcaattccttttagctatctttagctaaatatctcattcccatcagaacttttaacaatctttaattaaac |
41847044 |
T |
|
| Q |
130 |
atctcattcatatattgtctgtgtttctctcatttca------attcatgtcattcacatgttcttatccttccacctcttcatgtctttct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41847043 |
atctcattcatatattgtctgtgtttctctcatttcaatgtgtatttatgtcattcacatgttcttatccttccacctcttcatgtctttct |
41846952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University