View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21505_low_16 (Length: 225)
Name: NF21505_low_16
Description: NF21505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21505_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 48203197 - 48202989
Alignment:
| Q |
1 |
ataatacacattacacacaaatttgaatgtttgtttgtcatgggaaggagagtacctcttggcaacatctcattaatacacccatttcttcatttctcat |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48203197 |
ataatacacattacacacatatttgaatgtttgtttgtcatgggaaggagagtacctcttggtaacatctcattaatacacccatttcttcatttctcat |
48203098 |
T |
|
| Q |
101 |
tgtttgcagcaagttttgctgcaaccattgccataatcacaactatatgtagttttcgattccgaagaaaatcggaaccagacccaccaaaagctgaacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48203097 |
tgtttgcagcaagttttgctgcaaccattgccataatcacaactatatgtagttttcgattccgaagaaaatcggaaccagacccaccaaaagctgaacc |
48202998 |
T |
|
| Q |
201 |
attagaaac |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
48202997 |
attagaaac |
48202989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 126 - 169
Target Start/End: Original strand, 4083025 - 4083068
Alignment:
| Q |
126 |
cattgccataatcacaactatatgtagttttcgattccgaagaa |
169 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
4083025 |
cattgccataatcacaactctatgtagtgttcgatttcgaagaa |
4083068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University