View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21506_low_13 (Length: 307)
Name: NF21506_low_13
Description: NF21506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21506_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 12 - 108
Target Start/End: Original strand, 43203539 - 43203635
Alignment:
| Q |
12 |
gatgaaaacgataccatgatgtaaaaagaggcttcccgacgggaggagaaatggagcaatagtatccatgagaaagggaaagatttggaaatactag |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43203539 |
gatgaaaacgataccatgatgtaaaaagaggcttcccgacgggaggagaaatggagcaatagtatccatgagaaagggaaagatttggaaatactag |
43203635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 197 - 291
Target Start/End: Original strand, 43203724 - 43203818
Alignment:
| Q |
197 |
gagaacaaatcttgacacttttaaaatagaatagtatttagctcgttatcattaccgtgtccatttatatttgtaataatagtggacggcctatg |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43203724 |
gagaacaaatcttgacacttttaaaatagaatagtatttagctcgttatcattaccgtgtccatttatatttgaaataatagtggacggcctatg |
43203818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University