View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21506_low_17 (Length: 270)
Name: NF21506_low_17
Description: NF21506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21506_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 38918626 - 38918878
Alignment:
| Q |
1 |
tgcactatcatccttcttactagacgcaggagatggagcatcaccttcaacgtcgctgcggctcggagttttagaaggagttttcgacgacttaggagct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38918626 |
tgcactatcatccttcttactagacgcaggagatggagcatcaccttcaacgtcgctgctgctcggagttttggaaggagttttcgacgacttaggagct |
38918725 |
T |
|
| Q |
101 |
ggagatgaagatggagacttagcaccaaaaagttcagaaggtaacaaaaccttgtccaattgataaacagccaaaggaaattgttgtctcaaagcattgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38918726 |
ggagatgaagatggagacttagcaccaaaaagttcagaaggtaacaaaaccttgtccaattgataaacagccaaaggaaattgttgtctcaatgcattgt |
38918825 |
T |
|
| Q |
201 |
tgataggtacagtaacaactccagttgaaacattgacttggttaccttgtgaa |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38918826 |
tgataggtacagtaacaactccagttgaaacattgacttggttaccttgtgaa |
38918878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University