View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21506_low_20 (Length: 245)
Name: NF21506_low_20
Description: NF21506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21506_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 3 - 149
Target Start/End: Complemental strand, 25334000 - 25333854
Alignment:
| Q |
3 |
tttttaggttatcgtcttattagtctgaaatttccaacactatgtaaaaatgactaatcactattgagaaacttgtgaagcatataagatgtgtttttct |
102 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25334000 |
tttttaggttatcgtcttattagtccaaaatttccaacactatgtaaaaatgactaatcactattgagaaacttgtgaagtatataagatgtgtttttct |
25333901 |
T |
|
| Q |
103 |
atcgcaactgaactttcatacatacgcacgagtcagaaatcaaacat |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25333900 |
atcgcaactgaactttcatacatacgcacgagtcagaaatcaaacat |
25333854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 184 - 242
Target Start/End: Complemental strand, 25333758 - 25333700
Alignment:
| Q |
184 |
tacttattgatgctaccttgtacttgtacaattagtcccattcttgcaccccctatgct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
25333758 |
tacttattgatgctaccttgtacttgtactattagtcccattcttgcaccccttatgct |
25333700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 137 - 186
Target Start/End: Complemental strand, 25333839 - 25333790
Alignment:
| Q |
137 |
agaaatcaaacatctaaccaattgctaaagtggtccaaatctcctactac |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25333839 |
agaaatcaaacatctaaccaattgctaaagtggtccaaatctcctactac |
25333790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University