View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21506_low_22 (Length: 237)
Name: NF21506_low_22
Description: NF21506
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21506_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 38 - 184
Target Start/End: Complemental strand, 7082423 - 7082276
Alignment:
| Q |
38 |
tcttaatcttatgttatactattggaaactatgaagaggtagctataaaataaagtagtgataaaagaactgaatcatgagcgtggccaatatagattat |
137 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7082423 |
tcttaatcttatgtgatactattggaaactatgaagaggtagctttaaaataaagtagtgataaaagaactgaatcatgagcgtggccaatatagattgt |
7082324 |
T |
 |
| Q |
138 |
gtttcatgtagctgtctctg-tagtagaatataagagaagattcagct |
184 |
Q |
| |
|
||||||| | |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7082323 |
gtttcattttgctgtctctgatagtagaatataagagaagattcagct |
7082276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University