View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21507_low_11 (Length: 243)
Name: NF21507_low_11
Description: NF21507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21507_low_11 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 35331968 - 35331726
Alignment:
| Q |
1 |
aataaataagattagagatatcaatatcaatataggagaatgacacaaaatcatcgtgtctttcccgccttaaagatagtagatcgggccccattttttg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35331968 |
aataaatatgattagagatatcaatatcaatataggagaatgacacaaaatcatcgtgtctttcccgccttaaagatagtagatcgggccccattttttg |
35331869 |
T |
 |
| Q |
101 |
ggggagatttcgatttagcatcgacacatcagattgaaaatgtgtgactatctttaaggaagttaatcatgtttattttctcaaattattattggtttca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35331868 |
ggggagatttcgatttagcatcgacacattagattgaaaatgtgtgactatctttaaggaagttaatcatgtttattttctcaaattattatcagtttca |
35331769 |
T |
 |
| Q |
201 |
acctctaagtggagtggttcatagggaggttttagtttacttt |
243 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35331768 |
acctgtaagtggagtggttcatagggaggttttagtttacttt |
35331726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University