View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21508_high_10 (Length: 359)

Name: NF21508_high_10
Description: NF21508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21508_high_10
NF21508_high_10
[»] chr4 (1 HSPs)
chr4 (16-244)||(54912852-54913081)
[»] chr7 (1 HSPs)
chr7 (81-139)||(11464684-11464742)
[»] chr6 (1 HSPs)
chr6 (84-116)||(7338061-7338093)


Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 16 - 244
Target Start/End: Complemental strand, 54913081 - 54912852
Alignment:
16 caaaaggaggcaataagatcgttgctacgttgtggaaacacccttttgcaaggtttactgtattgtactctcatggtaatgctgctgatttgggtcagat 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
54913081 caaaaggaggcaataagatcgttgctacgttgtggaaacacccttttgcaaggtttactatattgtactctcatggtaatgctgctgatttgggtcagat 54912982  T
116 gcgtgacctcttcattgagcttagagctcatcttcgtgtcaatatcatgaggtttcttttcttaat-ccttatatacaattttgcatgcttttattaata 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
54912981 gcgtgacctcttcattgagcttagagctcatcttcgtgtcaatatcatgaggtttcttttcttaatcccttatatacaattttgcatgcttttattaata 54912882  T
215 caacagtttttgtctgttaattaataatta 244  Q
    ||||||||||||||||||||||||||||||    
54912881 caacagtttttgtctgttaattaataatta 54912852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 81 - 139
Target Start/End: Complemental strand, 11464742 - 11464684
Alignment:
81 tactctcatggtaatgctgctgatttgggtcagatgcgtgacctcttcattgagcttag 139  Q
    ||||||||||| || ||||||||| |||||||||||  ||| || ||||||||||||||    
11464742 tactctcatggcaacgctgctgatctgggtcagatgtatgagcttttcattgagcttag 11464684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 84 - 116
Target Start/End: Complemental strand, 7338093 - 7338061
Alignment:
84 tctcatggtaatgctgctgatttgggtcagatg 116  Q
    |||||||| ||||||||||||||||||||||||    
7338093 tctcatggaaatgctgctgatttgggtcagatg 7338061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University