View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21508_high_24 (Length: 231)
Name: NF21508_high_24
Description: NF21508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21508_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 80 - 222
Target Start/End: Original strand, 32125308 - 32125450
Alignment:
| Q |
80 |
gtttaatttttgaatgatttttctttataaaaattcgatttcggaaaatgggtttcgatcattctcaagtatgatgatttttctcatcaaagattcgttt |
179 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32125308 |
gtttgatttttgaatgatttttctttataaaaattcaatttcggaaaatgggtttcgatcattctcaagtatgatgatttttctcatcaaagattcgatt |
32125407 |
T |
 |
| Q |
180 |
ttggaaattgggttttgatcattttttctctcatgatattctt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32125408 |
ttggaaattgggttttgatcattttttctctcatgattttctt |
32125450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University