View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21508_low_11 (Length: 355)
Name: NF21508_low_11
Description: NF21508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21508_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 8 - 340
Target Start/End: Complemental strand, 37302673 - 37302341
Alignment:
| Q |
8 |
aagcatagggtaatggtgtgaagctaagaaaggggacaaaaaaggagcgatgggtccaaggttaattattttcttaataagacgggttggggtatctttc |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37302673 |
aagcttagggtaatggtgtgaagctaagaaaggggacaaaaaaggagcgatgggtccaaggttaattattttcttaataagacgggttggggtatctttc |
37302574 |
T |
|
| Q |
108 |
tttttgttannnnnnncctcttagagacagagatggagtgagcatttagtgaggttgccggaggatatatgatcaattaaaagccaacttgacagatggg |
207 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37302573 |
tttttgttatttttttcctcttagagacagagatggagtgagcatttagtgaggttgccggaggatatatgatcaattaaaagccaacttgacagatggg |
37302474 |
T |
|
| Q |
208 |
aaaaggttattattggataattcgatattgctgttgaggtatcgtccactagaattgtatctcgtttataatgagtagaactgtactactgttcgaagat |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37302473 |
aaaaggttattattggataattcgatattgctgttgaggtatcgtccactagaattgtatctcgtttataatgagtagaactgtactactgttcgaagat |
37302374 |
T |
|
| Q |
308 |
cggtattatttggtgtagttaaacgtcataaat |
340 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
37302373 |
cggtattatttggtgcagttaaacgtcataaat |
37302341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University