View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21508_low_6 (Length: 471)
Name: NF21508_low_6
Description: NF21508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21508_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 10 - 268
Target Start/End: Complemental strand, 43004365 - 43004101
Alignment:
| Q |
10 |
ataattctcctcaaaggttgttggttgagacaattgtggagcgtatcaagataaaggttttccaaatctcttgattcagtcacnnnnnnnatcttatttt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43004365 |
ataattctcctcaaaggttgttggttgagacaattgtggagcgtatcaagataaaggttttccaaatctcttgattcagtcactttttttatcttatttt |
43004266 |
T |
|
| Q |
110 |
cctcatagacataagacatggtgaaaatgcttcttt------atattcatattcatcttctattctaaccagctttgaaagtttcaatttatttctttgt |
203 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43004265 |
cctcttagacataagacatggtgaaaatgcttctttatattcatattcatattcatcttctattctaaccagctttgaaagtttcaatttatttctttgt |
43004166 |
T |
|
| Q |
204 |
tcttgatttgtgtgtttagaatgattcttgaaaatctcttaaatatttgaatttaatcatggaaa |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43004165 |
tcttgatttgtgtgtttagaatgattcttgaaaatctcttaaatatttgaatttaatcatggaaa |
43004101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 338 - 453
Target Start/End: Complemental strand, 43004031 - 43003916
Alignment:
| Q |
338 |
ctctctggaaaaatggatgtagcatctgatattcgtggttgggatgagttgatccccgatactttggcgctgattttcacgaaactttcactccgtgaaa |
437 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43004031 |
ctctctggaaaaatggaagtagcatctgatattcgtggttgggatgagttgatccccgatactttggcgctgattttcacgaaactttcactccgtgaaa |
43003932 |
T |
|
| Q |
438 |
gattgaccgtgatccc |
453 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
43003931 |
gattgaccatgatccc |
43003916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 347 - 453
Target Start/End: Original strand, 27071506 - 27071612
Alignment:
| Q |
347 |
aaaatggatgtagcatctgatattcgtggttgggatgagttgatccccgatactttggcgctgattttcacgaaactttcactccgtgaaagattgaccg |
446 |
Q |
| |
|
||||||| ||| ||||||||||||||| |||||| ||||||||||| ||||| |||| ||||||||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
27071506 |
aaaatggcagtatcatctgatattcgtgcttgggacgagttgatccctgataccttggggctgattttcacgaaactttcgctctgtgaaagattcaccg |
27071605 |
T |
|
| Q |
447 |
tgatccc |
453 |
Q |
| |
|
||||||| |
|
|
| T |
27071606 |
tgatccc |
27071612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University