View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21509_high_10 (Length: 207)
Name: NF21509_high_10
Description: NF21509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21509_high_10 |
 | |
|
| [»] scaffold0035 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 5823266 - 5823434
Alignment:
| Q |
19 |
aatattgaaacctgaccctgaacaagcaaatttcataacaaaagaatgttctggagaaaattgggaacgtataatcccaagaatttggcctaacacaaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5823266 |
aatattgaaacctgaccctgaacaagcaaatttcataacaaaagaatgttctggagaaaattgggaacgtataatcccaagaatttggcctaacacaaag |
5823365 |
T |
|
| Q |
119 |
taccttgaggttattgtcactggtgctatggctcagtacattccaacccttgattattacagtggtaac |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
5823366 |
taccttgaggttattgtcactggtgctatggctcagtacattcctacccttgattattatagtggtaac |
5823434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 56 - 187
Target Start/End: Complemental strand, 5832763 - 5832632
Alignment:
| Q |
56 |
acaaaagaatgttctggagaaaattgggaacgtataatcccaagaatttggcctaacacaaagtaccttgaggttattgtcactggtgctatggctcagt |
155 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
5832763 |
acaaaagaatgttcaggagacaattgggaacgtataatcccaagaatctggcctaacacaaagtatcttgaagttattgtcactggtgctatggctcagt |
5832664 |
T |
|
| Q |
156 |
acattccaacccttgattattacagtggtaac |
187 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |
|
|
| T |
5832663 |
acattcctacccttgattattacagtggtaac |
5832632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 74 - 184
Target Start/End: Original strand, 78088 - 78198
Alignment:
| Q |
74 |
gaaaattgggaacgtataatcccaagaatttggcctaacacaaagtaccttgaggttattgtcactggtgctatggctcagtacattccaacccttgatt |
173 |
Q |
| |
|
|||||||||||| | |||||| || |||||||||||||| || || | || || ||||| ||||||||||||||||| ||||||||||| ||| ||| |
|
|
| T |
78088 |
gaaaattgggaaggaataatcataaagatttggcctaacaccaaatatttagatgtcattgtaactggtgctatggctcaatacattccaacacttaatt |
78187 |
T |
|
| Q |
174 |
attacagtggt |
184 |
Q |
| |
|
| ||||||||| |
|
|
| T |
78188 |
actacagtggt |
78198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University