View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21509_high_9 (Length: 226)
Name: NF21509_high_9
Description: NF21509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21509_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 3 - 193
Target Start/End: Complemental strand, 44966685 - 44966490
Alignment:
| Q |
3 |
tatgaaaattttattttagaattttatattcgactgtttaaacatttaaaagatgttatttcaatgcaannnnnnnnnnnn------accaaaatgcaaa |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
44966685 |
tatgaaaattttattttagaattttatattcgactgtttaaacatttaaaagatgttttttcaatgcaattttaatttattttttttaccaaaatgcaaa |
44966586 |
T |
|
| Q |
97 |
aatgttagtcttaannnnnnngatgacaattgacaaatattagatgacccatatttatgatgatctcaaacaaagtatttgtaattcctctcctctc |
193 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44966585 |
aatgttagtcttaatttttt-gatgacaattgacaaatattagatgacccatatttatgatgatctgaaacaaagtatttgtaattcctctcctctc |
44966490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University