View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21509_low_7 (Length: 291)
Name: NF21509_low_7
Description: NF21509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21509_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 139 - 270
Target Start/End: Original strand, 28053675 - 28053806
Alignment:
| Q |
139 |
attagtagaaactcgaaacgacgacgtatcttcttttgtaatatcatcacttgagaatgtagcagtaacggtaacatctgaagcaaacaaactcgtcgcg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28053675 |
attagtagaaactcgaaacgacgacgtatcttcttttgtaatatcatcacttgagaatgtagcagtaacggtaacatctgaagcaaacaaactcgtcgcg |
28053774 |
T |
 |
| Q |
239 |
taactgcttccactcgacaatctagataacga |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28053775 |
taactgcttccactcgacaatctagataacga |
28053806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 28053537 - 28053599
Alignment:
| Q |
1 |
gaaagaaagcctcttcgccaacgctgtttgtagttcatagctttctttacactccttagcgta |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28053537 |
gaaagaaagcctcttcgccaacgctgtttgtagttcatagctttctttacactccttagcgta |
28053599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University