View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21509_low_8 (Length: 287)
Name: NF21509_low_8
Description: NF21509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21509_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 19 - 275
Target Start/End: Original strand, 54056523 - 54056790
Alignment:
| Q |
19 |
aggagggagcttgcaatggagggggcgtttggaaccatgcagaggcctctcaattctctatggtcaaattctacaccgacctgtgacaaggacaaagtta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54056523 |
aggagggagcttgcaatggagggggcgtttggaaccatgcagaggcctctcaattctctatggtcaaattctacaccgacctgtgacaaggacaaagtta |
54056622 |
T |
 |
| Q |
119 |
ttctattggtcagtttcattacgttttctattcttttc-----------ttttgtgtactgtaatcgttagttatattgacacccatgtacaaaaccatc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54056623 |
ttctattggtcagtttcattacgttttctactcttttcttttgtctttgttttgtgtactgtaattgttagttatattgacacccatgtacaaaaccatc |
54056722 |
T |
 |
| Q |
208 |
aatttaatctaggacatcgataaatagacatctctaaacttaatataatacatccttttaacatctca |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54056723 |
aatttaatctaggacatcgataaatagacatctctaaacttaatataatacatccttttaacatctca |
54056790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 97
Target Start/End: Original strand, 54456844 - 54456922
Alignment:
| Q |
19 |
aggagggagcttgcaatggagggggcgtttggaaccatgcagaggcctctcaattctctatggtcaaattctacaccga |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| | ||||||||||||||||||| |
|
|
| T |
54456844 |
aggagggagcttgcaatggagggggcgtttggaactatgcagaagcctctcaattctgtgtggtcaaattctacaccga |
54456922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 96 - 162
Target Start/End: Original strand, 54456987 - 54457053
Alignment:
| Q |
96 |
gacctgtgacaaggacaaagttattctattggtcagtttcattacgttttctattcttttcttttgt |
162 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| | || ||||||||||| |||| |||| |
|
|
| T |
54456987 |
gaccagtgacaaggacaaagttattctattggtcagtttcgtaactttttctattctcttctcttgt |
54457053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 20 - 63
Target Start/End: Complemental strand, 15039936 - 15039893
Alignment:
| Q |
20 |
ggagggagcttgcaatggagggggcgtttggaaccatgcagagg |
63 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
15039936 |
ggagggagcttgcaatggagaggacgtttggaaccatgcagagg |
15039893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University