View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2150_high_5 (Length: 320)
Name: NF2150_high_5
Description: NF2150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2150_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 97 - 225
Target Start/End: Original strand, 5554965 - 5555093
Alignment:
| Q |
97 |
cttaaagaaaaagtctggcccaatttaagcctcatgcagaataatcagtaggttcttgtcagccaatctatcttatttccccctagttggaatgtatgta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5554965 |
cttaaagaaaaagtctggcccaatttaagcctcatgcagaataatcagtaggttcttgtcagccaatctatcttatttccccctagttggaatgtatgta |
5555064 |
T |
|
| Q |
197 |
tatactcaattagaagtttgagaagatgt |
225 |
Q |
| |
|
||||||||||| ||||||||||||||||| |
|
|
| T |
5555065 |
tatactcaattggaagtttgagaagatgt |
5555093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 217 - 300
Target Start/End: Original strand, 5555123 - 5555206
Alignment:
| Q |
217 |
agaagatgtggcattagtgctaattataattcattactcacatcatcatccaataggggaagagacataaatataagtctcaga |
300 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5555123 |
agaagatgtggcattagtgctaataataattcattactcacatcattatccaattggggaagagacataaatataagtctcaga |
5555206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University