View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2150_high_9 (Length: 257)
Name: NF2150_high_9
Description: NF2150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2150_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 47 - 134
Target Start/End: Original strand, 9019485 - 9019572
Alignment:
| Q |
47 |
aacgaaatctaataaggctttgtttgggagttatgnnnnnnntaaataatcggtgaatcactatttcagtcttgaaattgttgaagtt |
134 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||| | |||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9019485 |
aacgtaatctactaaggctttgtttgggagttaagataaaaataaaaaatcggtgaatcactatttcagtcttataattgttgaagtt |
9019572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 214 - 255
Target Start/End: Original strand, 9019698 - 9019739
Alignment:
| Q |
214 |
attcagtctctagctgaaacaatcattgatcaaactttactt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9019698 |
attcagtctctagctgaaacaatcattgatcaaactttactt |
9019739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 215
Target Start/End: Original strand, 9019615 - 9019675
Alignment:
| Q |
155 |
aaaattgccaaccaagtagtcaaactcgaatggttgataactaatgagtttcagttaagat |
215 |
Q |
| |
|
|||||| |||||||||| ||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
9019615 |
aaaattcccaaccaagtgatcaaacttgaatggttgataactaatgagcttcagttaagat |
9019675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University