View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2150_low_10 (Length: 312)
Name: NF2150_low_10
Description: NF2150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2150_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 3e-82; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 128 - 301
Target Start/End: Original strand, 32718029 - 32718203
Alignment:
| Q |
128 |
aaatagtgtagattaagctttaacaagaattgatttgaaaatttgagaataatcgaaagttttgattacattttttaaaccgtgttagtagaaatatggg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32718029 |
aaatagtgtagattaagctttaacaagaattgatttgaaaatttgagaataatcgaaagttttgattacattttttaaaccgggttagtagaaatatggg |
32718128 |
T |
 |
| Q |
228 |
gagaggcaaggatacagttttgt-gagtgatgaatgggttggtgcagtcaccttaaaaagggggtttgacctgat |
301 |
Q |
| |
|
||||||||||||||||||||| | || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32718129 |
gagaggcaaggatacagttttttggactgatgaatgggttggtgcagtcaccttaaaaagggggtttgacctgat |
32718203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 32717887 - 32717940
Alignment:
| Q |
1 |
tttttctggttaagttgtcatattgttcaagaccaatgaaaaaagatgcataac |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32717887 |
tttttctggttaagttgtcatattgttcaagaccaatgaaaaaagatgcataac |
32717940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 73 - 109
Target Start/End: Original strand, 32717958 - 32717994
Alignment:
| Q |
73 |
ctgtaaaatagacgtcaacactataaatctcctttgc |
109 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32717958 |
ctgtaaaatagacgtcaaaactataaatctcctttgc |
32717994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University