View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2150_low_16 (Length: 257)

Name: NF2150_low_16
Description: NF2150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2150_low_16
NF2150_low_16
[»] chr4 (3 HSPs)
chr4 (47-134)||(9019485-9019572)
chr4 (214-255)||(9019698-9019739)
chr4 (155-215)||(9019615-9019675)


Alignment Details
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 47 - 134
Target Start/End: Original strand, 9019485 - 9019572
Alignment:
47 aacgaaatctaataaggctttgtttgggagttatgnnnnnnntaaataatcggtgaatcactatttcagtcttgaaattgttgaagtt 134  Q
    |||| |||||| ||||||||||||||||||||| |       |||| ||||||||||||||||||||||||||  |||||||||||||    
9019485 aacgtaatctactaaggctttgtttgggagttaagataaaaataaaaaatcggtgaatcactatttcagtcttataattgttgaagtt 9019572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 214 - 255
Target Start/End: Original strand, 9019698 - 9019739
Alignment:
214 attcagtctctagctgaaacaatcattgatcaaactttactt 255  Q
    ||||||||||||||||||||||||||||||||||||||||||    
9019698 attcagtctctagctgaaacaatcattgatcaaactttactt 9019739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 215
Target Start/End: Original strand, 9019615 - 9019675
Alignment:
155 aaaattgccaaccaagtagtcaaactcgaatggttgataactaatgagtttcagttaagat 215  Q
    |||||| ||||||||||  ||||||| ||||||||||||||||||||| ||||||||||||    
9019615 aaaattcccaaccaagtgatcaaacttgaatggttgataactaatgagcttcagttaagat 9019675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University