View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21511_high_3 (Length: 374)
Name: NF21511_high_3
Description: NF21511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21511_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 18 - 363
Target Start/End: Original strand, 1850632 - 1850977
Alignment:
| Q |
18 |
tgaaagacctacagtgttgtatgagactgtatgttggatagcagagaaccaacaaaatagtaagttcagtattccagagatgaggtgagaacattacagt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1850632 |
tgaaagacctacagtgttgtatgagactgtatgttggatagcagagaaccaacaaaatagtaagttcagtattccagagatgaggtgagaatgttacagt |
1850731 |
T |
 |
| Q |
118 |
gagtgaattgtcacacaagacaatacataatcaggaattaagtcattagagcgaaaattggggtagctcccactgtaagaaaatggtagagtcctggctt |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
1850732 |
gagtgagttgtcacacaagacaatacataatcaggaatcaagtcattagagcgaaaattggggtagctcccaccgtaggaaaatggtagagtcctggctt |
1850831 |
T |
 |
| Q |
218 |
gcgtggtttaagtacgagtgaagaacattcatagaagcactgactaggaaggtagaccagatacagggtagtcaaattcattgctgtgttctttatgtga |
317 |
Q |
| |
|
| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1850832 |
gtgtggtttaagtaaaagtgaagaacattcatagaagcactgactaggaaggtagaccagatacagggtagccaaattcattgctgtgttctttatgtga |
1850931 |
T |
 |
| Q |
318 |
ttttgtgttctttataagtcttgtttttcaaggtttttgctgtctg |
363 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1850932 |
ttttgtgctctttataagtctcgtttttcaaggtttttgctgtctg |
1850977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University