View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21511_high_5 (Length: 288)
Name: NF21511_high_5
Description: NF21511
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21511_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 12 - 190
Target Start/End: Original strand, 44965672 - 44965850
Alignment:
| Q |
12 |
atgagagtggtaacgaagcatttgggtaagagtaggtcatcgggtacggtggccggagccagttctccggcgaacaggagtgatgatacgctgttgcagc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44965672 |
atgagagtggtaacgaagcatttgggtaagagtaggtcatcgggtacggtggccggagctagttctccggcgaacaggagtgatgatacgttgttgcagc |
44965771 |
T |
 |
| Q |
112 |
agcatgatggaattcaaagtgctattcttcattgcaagagatccttcaattccagaggtaaaatttgtttcaaaattgg |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44965772 |
agcatgatggaattcaaagtgctattcttcattgcaagagatccttcaattccagaggtaaaatttgtttcaaaattgg |
44965850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 91 - 161
Target Start/End: Original strand, 2502541 - 2502611
Alignment:
| Q |
91 |
gtgatgatacgctgttgcagcagcatgatggaattcaaagtgctattcttcattgcaagagatccttcaat |
161 |
Q |
| |
|
|||||||| |||| ||||||||||| |||||||||||| | || ||| | || |||||||||||||||||| |
|
|
| T |
2502541 |
gtgatgattcgcttttgcagcagcaagatggaattcaaggagccattttacactgcaagagatccttcaat |
2502611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 32 - 131
Target Start/End: Original strand, 28697958 - 28698056
Alignment:
| Q |
32 |
tttgggtaagagtaggtcatcgggtacggtggccggagccagttctccggcgaacaggagtgatgatacgctgttgcagcagcatgatggaattcaaagt |
131 |
Q |
| |
|
|||||||||||||||||| ||| ||| |||||||||| || |||||||||| | ||||||||| | | |||||||||| |||||||||| |||||| |
|
|
| T |
28697958 |
tttgggtaagagtaggtcgccggataccgtggccggagttggtactccggcgaataagagtgatga-atgttgttgcagcaagatgatggaatccaaagt |
28698056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University