View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21512_high_3 (Length: 250)
Name: NF21512_high_3
Description: NF21512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21512_high_3 |
 |  |
|
| [»] scaffold0148 (1 HSPs) |
 |  |  |
|
| [»] scaffold0280 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0148 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 25 - 234
Target Start/End: Complemental strand, 27710 - 27501
Alignment:
| Q |
25 |
agtgccaggcttactcatatggtcaggtccctgataagcagcagcgtggtcttattccttcaaactgttggatctggacacaaagtttaactactcttaa |
124 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27710 |
agtgccaggcttactcatatgctcaagtccctgataagcagcagcgtggtcttattccttcaaactgttggatctggacacacagtttaactactcttaa |
27611 |
T |
 |
| Q |
125 |
agaagagtatactagttgggatgatgatcgtagactcattatcctagttgataaattagacataggtatgcatatgatgattaaattagagacatatttc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27610 |
agaagagtatactagttgggatgatgatcgtagactcattatcctagttgataaattagacataggtatgcatatgatgattaaattagagacatatttc |
27511 |
T |
 |
| Q |
225 |
tctcttcttc |
234 |
Q |
| |
|
|||||||||| |
|
|
| T |
27510 |
tctcttcttc |
27501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0280 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 82 - 214
Target Start/End: Complemental strand, 2617 - 2485
Alignment:
| Q |
82 |
cttcaaactgttggatctggacacaaagtttaactactcttaaagaagagtatactagttgggatgatgatcgtagactcattatcctagttgataaatt |
181 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
2617 |
cttcaaattgttggatctggacacaaagtttaactactcttaaagaagagtatactaattgggattatgatcgtagactcattgtcctagttgataaatc |
2518 |
T |
 |
| Q |
182 |
agacataggtatgcatatgatgattaaattaga |
214 |
Q |
| |
|
||| ||||||||||| |||||||||||||||| |
|
|
| T |
2517 |
agaggtaggtatgcatgtgatgattaaattaga |
2485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University