View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21512_low_5 (Length: 237)
Name: NF21512_low_5
Description: NF21512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21512_low_5 |
 |  |
|
| [»] scaffold0227 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 93 - 168
Target Start/End: Original strand, 18259745 - 18259820
Alignment:
| Q |
93 |
actagttaaggaagttaaaagagagttttgaattaaaaatgtcactttttatagttttaagaccttgaatgcacaa |
168 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
18259745 |
actagttaaagaagttaaaagagagttttgaattaaaaatgtcattttttatactttttagaccttgaatgcacaa |
18259820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 61 - 105
Target Start/End: Original strand, 36603640 - 36603684
Alignment:
| Q |
61 |
aaatgggtcatgttaaccagtgcccccggggaactagttaaggaa |
105 |
Q |
| |
|
||||||||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
36603640 |
aaatgggtcatgttaaccagtaccccgggggcactagttaaggaa |
36603684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 66 - 102
Target Start/End: Original strand, 5411913 - 5411949
Alignment:
| Q |
66 |
ggtcatgttaaccagtgcccccggggaactagttaag |
102 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5411913 |
ggtcatgttaaccagtgccttcggggaactagttaag |
5411949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 66 - 170
Target Start/End: Original strand, 50384589 - 50384692
Alignment:
| Q |
66 |
ggtcatgttaaccagtgcccccggggaactagttaaggaagttaaaagaga--gttttgaattaaaaatgtcactttttatagttttaagaccttgaatg |
163 |
Q |
| |
|
||||||||||||| |||||| || ||| |||||||||||||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50384589 |
ggtcatgttaaccggtgccc---ggacactggttaaggaagttaaaagagaaagttttaaattaaaaatgtcactttttatacttttaagaccttgaatg |
50384685 |
T |
 |
| Q |
164 |
cacaagt |
170 |
Q |
| |
|
||||||| |
|
|
| T |
50384686 |
cacaagt |
50384692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 65 - 152
Target Start/End: Original strand, 23670422 - 23670509
Alignment:
| Q |
65 |
gggtcatgttaaccagtgcccccggggaactagttaaggaagttaaaagaga--gttttgaattaaaaatgtcactttttatagttttaa |
152 |
Q |
| |
|
||||||| ||||||| ||| |||||| |||||||||||||||||||||||| ||||| |||| ||||||||||||||||| |||||| |
|
|
| T |
23670422 |
gggtcattttaaccaatgcgtccggggcactagttaaggaagttaaaagagaaggttttaaatt--aaatgtcactttttatacttttaa |
23670509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 65 - 152
Target Start/End: Original strand, 24042698 - 24042785
Alignment:
| Q |
65 |
gggtcatgttaaccagtgcccccggggaactagttaaggaagttaaaagaga--gttttgaattaaaaatgtcactttttatagttttaa |
152 |
Q |
| |
|
||||||| ||||||| ||| |||||| |||||||||||||||||||||||| ||||| |||| ||||||||||||||||| |||||| |
|
|
| T |
24042698 |
gggtcattttaaccaatgcgtccggggcactagttaaggaagttaaaagagaaggttttaaatt--aaatgtcactttttatacttttaa |
24042785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 170
Target Start/End: Original strand, 40397451 - 40397520
Alignment:
| Q |
98 |
ttaaggaagttaaaagaga--gttttgaattaaaaatgtcactttttatagttttaagaccttgaatgcacaagt |
170 |
Q |
| |
|
||||||||||||||||||| ||||| |||| |||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
40397451 |
ttaaggaagttaaaagagaaagttttaaatttaaaatgtcacttttta-----ttaaaaccttgaatgcacaagt |
40397520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 106
Target Start/End: Complemental strand, 50121200 - 50121164
Alignment:
| Q |
70 |
atgttaaccagtgcccccggggaactagttaaggaag |
106 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
50121200 |
atgttaaccaatgcccccggggcactagttaaggaag |
50121164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 6e-21; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 98 - 170
Target Start/End: Complemental strand, 38204753 - 38204679
Alignment:
| Q |
98 |
ttaaggaagttaaaagaga--gttttgaattaaaaatgtcactttttatagttttaagaccttgaatgcacaagt |
170 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
38204753 |
ttaaggaagttaaaagagaaagttttgaattaaaaatgtcactttttatacttttaagattttgaatgcacaagt |
38204679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 170
Target Start/End: Original strand, 6621469 - 6621530
Alignment:
| Q |
109 |
aaaagagagttttgaattaaaaatgtcactttttatagttttaagaccttgaatgcacaagt |
170 |
Q |
| |
|
|||||| |||||| ||||||||||||||| |||||| ||||||||| |||||||||||||| |
|
|
| T |
6621469 |
aaaagaaagttttatattaaaaatgtcactctttatatttttaagactttgaatgcacaagt |
6621530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 64 - 112
Target Start/End: Original strand, 25833 - 25881
Alignment:
| Q |
64 |
tgggtcatgttaaccagtgcccccggggaactagttaaggaagttaaaa |
112 |
Q |
| |
|
||||||||| |||| |||||||| ||||||||||||||||||| ||||| |
|
|
| T |
25833 |
tgggtcatgctaacaagtgcccctggggaactagttaaggaagctaaaa |
25881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 63 - 112
Target Start/End: Original strand, 21348913 - 21348962
Alignment:
| Q |
63 |
atgggtcatgttaaccagtgcccccggggaactagttaaggaagttaaaa |
112 |
Q |
| |
|
|||||||||| |||| |||||||| |||||||||||||||||| ||||| |
|
|
| T |
21348913 |
atgggtcatgctaacaagtgcccctagggaactagttaaggaagctaaaa |
21348962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 118 - 170
Target Start/End: Complemental strand, 8108059 - 8108007
Alignment:
| Q |
118 |
ttttgaattaaaaatgtcactttttatagttttaagaccttgaatgcacaagt |
170 |
Q |
| |
|
|||| ||||||||||||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
8108059 |
ttttaaattaaaaatgtcacattttatacttttaagaccttgaatgcataagt |
8108007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 64 - 105
Target Start/End: Original strand, 9799198 - 9799239
Alignment:
| Q |
64 |
tgggtcatgttaaccagtgcccccggggaactagttaaggaa |
105 |
Q |
| |
|
||||||||||||||||||||||||| || ||| ||||||||| |
|
|
| T |
9799198 |
tgggtcatgttaaccagtgcccccgtggcactggttaaggaa |
9799239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 57 - 112
Target Start/End: Complemental strand, 40234711 - 40234656
Alignment:
| Q |
57 |
ataaaaatgggtcatgttaaccagtgcccccggggaactagttaaggaagttaaaa |
112 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||| ||| ||||||||| |||||| |
|
|
| T |
40234711 |
ataaaaatgggtcatgttaaccggtgctcccggggcactggttaaggaatttaaaa |
40234656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 2 - 64
Target Start/End: Complemental strand, 3929619 - 3929557
Alignment:
| Q |
2 |
gtccatactaatgccgatctgcaatatatcagtaaaattattagcaccagactaaataaaaat |
64 |
Q |
| |
|
|||||||| ||||| |||||||| ||||||||||||| ||| |||||||||||||| ||||| |
|
|
| T |
3929619 |
gtccataccaatgctgatctgcagtatatcagtaaaagtataggcaccagactaaatcaaaat |
3929557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 59 - 106
Target Start/End: Complemental strand, 30703869 - 30703822
Alignment:
| Q |
59 |
aaaaatgggtcatgttaaccagtgcccccggggaactagttaaggaag |
106 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||| ||| |||||||||| |
|
|
| T |
30703869 |
aaaaaagggtcatgttaaccaatgcccccggggcactggttaaggaag |
30703822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000008; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 63 - 105
Target Start/End: Complemental strand, 26127415 - 26127373
Alignment:
| Q |
63 |
atgggtcatgttaaccagtgcccccggggaactagttaaggaa |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26127415 |
atgggtcttgttaaccagtgcccccggggcactagttaaggaa |
26127373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 97 - 170
Target Start/End: Original strand, 15892146 - 15892222
Alignment:
| Q |
97 |
gttaaggaagttaaaa-gag--agttttgaattaaaaatgtcactttttatagttttaagaccttgaatgcacaagt |
170 |
Q |
| |
|
|||||||||||||||| ||| |||||| |||||||||| |||||||||||| ||| |||||||| |||| |||||| |
|
|
| T |
15892146 |
gttaaggaagttaaaaagaggaagttttaaattaaaaatatcactttttatactttcaagaccttaaatgtacaagt |
15892222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 97 - 170
Target Start/End: Complemental strand, 17872606 - 17872534
Alignment:
| Q |
97 |
gttaaggaagttaaaagagagttttgaattaaaaatgtcactttttatagttttaagaccttgaatgcacaagt |
170 |
Q |
| |
|
|||||||||||||| ||| | |||| ||||||||| |||| | |||||| |||||| ||||||||||||||||| |
|
|
| T |
17872606 |
gttaaggaagttaagagaaaattttaaattaaaaaagtcaatatttatacttttaa-accttgaatgcacaagt |
17872534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 66 - 121
Target Start/End: Complemental strand, 25113956 - 25113901
Alignment:
| Q |
66 |
ggtcatgttaaccagtgcccccggggaactagttaaggaagttaaaagagagtttt |
121 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||| |||| ||| |||| |
|
|
| T |
25113956 |
ggtcatgttaaccagtgcctccgggacactagttaaggaagtaaaaatagaatttt |
25113901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 52 - 105
Target Start/End: Original strand, 36781826 - 36781879
Alignment:
| Q |
52 |
actaaataaaaatgggtcatgttaaccagtgcccccggggaactagttaaggaa |
105 |
Q |
| |
|
||||| |||| ||||||| |||||||| ||||||||| || ||||||||||||| |
|
|
| T |
36781826 |
actaattaaatatgggtcctgttaaccggtgcccccgaggcactagttaaggaa |
36781879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 105
Target Start/End: Original strand, 19940548 - 19940588
Alignment:
| Q |
65 |
gggtcatgttaaccagtgcccccggggaactagttaaggaa |
105 |
Q |
| |
|
|||||||||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
19940548 |
gggtcatgttaaccggtgcccccggggcactggttaaggaa |
19940588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 88 - 150
Target Start/End: Complemental strand, 31938282 - 31938218
Alignment:
| Q |
88 |
ggggaactagttaaggaagttaaaagaga--gttttgaattaaaaatgtcactttttatagtttt |
150 |
Q |
| |
|
|||| ||| |||||| ||||||||||||| ||||| ||||||||||||||||||||||| |||| |
|
|
| T |
31938282 |
ggggcactggttaagaaagttaaaagagaaagttttaaattaaaaatgtcactttttatactttt |
31938218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 54 - 102
Target Start/End: Original strand, 38068825 - 38068873
Alignment:
| Q |
54 |
taaataaaaatgggtcatgttaaccagtgcccccggggaactagttaag |
102 |
Q |
| |
|
|||| ||||| ||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
38068825 |
taaaaaaaaaagggtcatgttaactagtgcccccggggcactagttaag |
38068873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 66 - 102
Target Start/End: Complemental strand, 47089360 - 47089324
Alignment:
| Q |
66 |
ggtcatgttaaccagtgcccccggggaactagttaag |
102 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47089360 |
ggtcatgttaaccagtgcccccggggcactagttaag |
47089324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 112
Target Start/End: Original strand, 26784689 - 26784736
Alignment:
| Q |
65 |
gggtcatgttaaccagtgcccccggggaactagttaaggaagttaaaa |
112 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||| |||| |||| |
|
|
| T |
26784689 |
gggtcatgttaactagtgcccccggggcactagttaagaaagtaaaaa |
26784736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 123 - 170
Target Start/End: Complemental strand, 4833 - 4786
Alignment:
| Q |
123 |
aattaaaaatgtcactttttatagttttaagaccttgaatgcacaagt |
170 |
Q |
| |
|
|||||||||||||| |||||||| |||||| | ||||||||||||||| |
|
|
| T |
4833 |
aattaaaaatgtcaatttttatacttttaaaatcttgaatgcacaagt |
4786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 63 - 107
Target Start/End: Original strand, 14158276 - 14158320
Alignment:
| Q |
63 |
atgggtcatgttaaccagtgcccccggggaactagttaaggaagt |
107 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||| |||| |
|
|
| T |
14158276 |
atgggtcatgttaacctgtgcccccgggacactagttaagaaagt |
14158320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University