View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21513_low_19 (Length: 498)
Name: NF21513_low_19
Description: NF21513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21513_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 1e-51; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 86 - 208
Target Start/End: Original strand, 3239155 - 3239275
Alignment:
| Q |
86 |
taacaattgcaaaaggtatgtttcataataacaattagttttacatttttggtataaaacaccatatgggttttgtatcatccacaaatcttatctaaag |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3239155 |
taacaattgcaaaaggtatgtttcataataacaattagttttacatttttggtataaaacaccatatgggttttgtatcatccacaaatcttatctaa-- |
3239252 |
T |
 |
| Q |
186 |
ttaaatgcacatcctatatcgag |
208 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
3239253 |
gtaaatacacatcctatatcgag |
3239275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 3239094 - 3239003
Alignment:
| Q |
1 |
cctttaggaaaattaaaattgtcaacattcaaataaattgacaatgacaagtaacctgggttgttcttgctcccttttggattcataacaat |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3239094 |
cctttaggaaaattaaaattgtcaacattcaaataaattgacaatgacaagtaacctgggttgttcttgctcccttttggattcataacaat |
3239003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 380 - 450
Target Start/End: Original strand, 3243501 - 3243571
Alignment:
| Q |
380 |
atcagaaaccgaacaggagttcaaagaaagtaattattattggagtgtcgacaagttcgtacatttggatg |
450 |
Q |
| |
|
||||||||| ||||||||| |||| | ||||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
3243501 |
atcagaaactgaacaggagctcaatgcaagtaattattgctggagtgtcgacaagttcatacatttggatg |
3243571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 36 - 92
Target Start/End: Complemental strand, 3243204 - 3243148
Alignment:
| Q |
36 |
aattgacaatgacaagtaacctgggttgttcttgctcccttttggattcataacaat |
92 |
Q |
| |
|
|||||| |||||||||||||| | |||||||| | |||||||||||||||||||||| |
|
|
| T |
3243204 |
aattgataatgacaagtaaccagagttgttctcgttcccttttggattcataacaat |
3243148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University