View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21513_low_26 (Length: 402)
Name: NF21513_low_26
Description: NF21513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21513_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 297; Significance: 1e-167; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 19 - 376
Target Start/End: Complemental strand, 4845387 - 4845031
Alignment:
| Q |
19 |
gtcaaatcctgaattccttgctgattgatggaactgcaactcaagaccttctcaatccagactgagttctcactggagtcagggaaacttgttgataaag |
118 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4845387 |
gtcaaatcctgaattccttgctgat----ggaactgcaactaaagaccttctcaatccagactgagttctcactggagtcagggaaactcagtgataaag |
4845292 |
T |
 |
| Q |
119 |
tgcgtttgattatattcgattcacaaactataaggatcaaatacaaagggatttgtggatgaatcaattagccaagtatgttttt--gcaaattgagttt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
4845291 |
tgcgtttgattatattcgattcacaaactataaggatcaaatacaaagggatttgtggatgaatcaattagccaagtatttttttttgcaaattgagttt |
4845192 |
T |
 |
| Q |
217 |
tgacacctcactgttctattcgaaatataaaaggttccggccatcggacatttaagttgcggttgagatgatgcacttttcttgggggcaggtaaggcag |
316 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4845191 |
tgacacctcactgttctatttgaaatataaaaggttccggccatcggacatttaagttgcggttgatatgatgcacttttcttgggggcaggtaaggcag |
4845092 |
T |
 |
| Q |
317 |
ttgttgcttttgaagttgcggcttgcggca-agccatggctggtggaggctgcaaagcttc |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4845091 |
ttgttgcttttgaagttgcggcttgcggcatagccatggctggtggaggctgcaaagcttc |
4845031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 244 - 331
Target Start/End: Complemental strand, 4865632 - 4865545
Alignment:
| Q |
244 |
taaaaggttccggccatcggacatttaagttgcggttgagatgatgcacttttcttgggggcaggtaaggcagttgttgcttttgaag |
331 |
Q |
| |
|
||||||||||| |||||||||||||| || | || ||||||||||||||| | ||||||| ||||||||||| ||||||||| |||| |
|
|
| T |
4865632 |
taaaaggttcctgccatcggacatttcagcggtgggtgagatgatgcacttgttttggggggaggtaaggcaggtgttgctttcgaag |
4865545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 150 - 208
Target Start/End: Complemental strand, 4818893 - 4818834
Alignment:
| Q |
150 |
aaggatcaaatacaaagggatttgtggatgaatcaa-ttagccaagtatgtttttgcaaa |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||| |||| ||||| |
|
|
| T |
4818893 |
aaggatcaaatacaaagggatttgtggatgaataaatttagccaagtattttttcgcaaa |
4818834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 251 - 331
Target Start/End: Complemental strand, 4814722 - 4814643
Alignment:
| Q |
251 |
ttccggccatcggacatttaagttgcggttgagatgatgcacttttcttgggggcaggtaaggcagttgttgcttttgaag |
331 |
Q |
| |
|
|||| |||||| ||||||| ||| ||||||||||||||| |||||||| ||||||||||||| || ||||||||| |||| |
|
|
| T |
4814722 |
ttccagccatctgacatttcagtgacggttgagatgatgcccttttctt-ggggcaggtaaggtaggtgttgctttagaag |
4814643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University