View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21513_low_30 (Length: 358)
Name: NF21513_low_30
Description: NF21513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21513_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 1e-75; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 66 - 241
Target Start/End: Original strand, 1042218 - 1042392
Alignment:
| Q |
66 |
aaagttttattcataagagtaagatcgttagcattgttttgtgatttggacctgtgtggaaaatgttgatattaataagttatattctgaaatatttgtt |
165 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
1042218 |
aaagttttattcataagagtaagattgttaacattgtttggtgatttggacctgtgtggaaaat-ttgatattaataagttatattctgaaatatttgat |
1042316 |
T |
|
| Q |
166 |
gcagcatctcgacgaggaaaaaattatgaacattgtgagtcctgaaaaggatgtggatggatttcatcctttaaat |
241 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1042317 |
gcagcatcttgacgaggaaagaattatgaacattgtgagtcctgaaaaggatgtggatggatttcatcctttaaat |
1042392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 238 - 328
Target Start/End: Original strand, 1042484 - 1042574
Alignment:
| Q |
238 |
aaatcagaggggaaaaagttgcaataatcggaaggggtaaaattgctggattaccaacctcattgctattgcaagtaacaataaaatgttg |
328 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||||| || |||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
1042484 |
aaatcagagggaaaagagttgcaataatcggaaggggtaaaattgcagggttaccaacttcattgctattgcaggtaacaataaaatgttg |
1042574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 238 - 328
Target Start/End: Original strand, 1066105 - 1066195
Alignment:
| Q |
238 |
aaatcagaggggaaaaagttgcaataatcggaaggggtaaaattgctggattaccaacctcattgctattgcaagtaacaataaaatgttg |
328 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| |||||||| ||| ||||| | ||||||||| |||| ||||||||||||||||| |
|
|
| T |
1066105 |
aaatcagagggaaaaaagttgcaataattggaagggataaaattgttgggttaccggcttcattgctaatgcaggtaacaataaaatgttg |
1066195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University