View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21513_low_35 (Length: 326)
Name: NF21513_low_35
Description: NF21513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21513_low_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-166; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 3239094 - 3238779
Alignment:
| Q |
1 |
cctttaggaaaattaaaattgtcaacattcaaataaattgacaatgacaagtaacctgggttgttcttgctcccttttggattcataacaatccgcctgn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3239094 |
cctttaggaaaattaaaattgtcaacattcaaataaattgacaatgacaagtaacctgggttgttcttgctcccttttggattcataacaatccgcctga |
3238995 |
T |
|
| Q |
101 |
nnnnnntatcgaaaacatacaaaaattgagcacatgacaatgatgatatgtgtatgtagtaaattggaatttactcagagcatgaatagcctttgaggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3238994 |
aaaaaatatcgaaaacatacaaaaattgagcacatgacaatgatgatatgtgtatgtagtaaattggaatttactcagagcatgaatagcctttgaggaa |
3238895 |
T |
|
| Q |
201 |
gaaactttctgagtacgtcttagaatcacatttggagaagttattaatcgtccatgtgaattgctcaatcgtccctggggatttcttctcaattgcttta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3238894 |
gaaactttctgagtacgtcttagaatcacatttggagaagttattaatcgtccatgtgaattgctcaatcgtccctggggatttcttctcaattgcttta |
3238795 |
T |
|
| Q |
301 |
ctgtttcagtgatgat |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3238794 |
ctgtttcagtgatgat |
3238779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 208 - 281
Target Start/End: Complemental strand, 3243022 - 3242949
Alignment:
| Q |
208 |
tctgagtacgtcttagaatcacatttggagaagttattaatcgtccatgtgaattgctcaatcgtccctgggga |
281 |
Q |
| |
|
||||||||| ||| ||||||||| || |||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3243022 |
tctgagtacatctgagaatcacacttagagaagttcttaatcgtccatgtgaattgctcaatcgtccatgggga |
3242949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 36 - 99
Target Start/End: Complemental strand, 3243204 - 3243141
Alignment:
| Q |
36 |
aattgacaatgacaagtaacctgggttgttcttgctcccttttggattcataacaatccgcctg |
99 |
Q |
| |
|
|||||| |||||||||||||| | |||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
3243204 |
aattgataatgacaagtaaccagagttgttctcgttcccttttggattcataacaatccgcctg |
3243141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University