View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21513_low_37 (Length: 308)
Name: NF21513_low_37
Description: NF21513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21513_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 290
Target Start/End: Complemental strand, 26346642 - 26346354
Alignment:
| Q |
1 |
aaaacgtggaaagaaaataaaagtgtgcaaaatgcataagtgtgcaaaatgcattgcatcttgcatacataaaccgaataaaccaaaactactacaagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26346642 |
aaaacgtggaaagaaaataaaagtgtgcaaaatgattaagtgtgcaaaatgcattgcatcttgcatacataaaccgaataaaccaaaactactacaagtc |
26346543 |
T |
 |
| Q |
101 |
aaaaatagtctagtaatttcatnnnnnnnnnnnnnnaaacatttaagatcaaaattttgatggctatagtggtagaagaaggcattcttgaaatttattg |
200 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26346542 |
aaaaatagtctagtaatt-catcacacacacacacaaaacatttaagatcaaaattttgatggctatagtggtagaagaaggcattcttgaaatttattg |
26346444 |
T |
 |
| Q |
201 |
cgtactttagaaagggaaaataacttgctttgtgatatgcatttggttactacaatgtgttagctgatagaataaacaaagaataattgg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26346443 |
cgtactttagaaagggaaaataacttgccttgtgatatgcatttggttactacaatgtgttagctgatagaataaacaaagaataattgg |
26346354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University