View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21513_low_40 (Length: 273)
Name: NF21513_low_40
Description: NF21513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21513_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 97 - 262
Target Start/End: Original strand, 36001567 - 36001732
Alignment:
| Q |
97 |
gtcagggagactttctaagttgcagcagtttaccatccttaggtgttttacagatcgtatggaatgaaatatgaaccacagattccatgtgttgatttga |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36001567 |
gtcagggagactttctaagttgcagcagtttaccatccttaggtgttttacagatcgtatgaaatgaaatatgaaccacagattccatgtgttgatttga |
36001666 |
T |
|
| Q |
197 |
gtgcatcctgacaggtcacaaaatataagagactccaatcctggatcgtttggtaaattcatctca |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36001667 |
gtgcatcctgacaggtcacaaaatataagagactccaatcctggatcgtttggtaaattcttctca |
36001732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 167 - 248
Target Start/End: Complemental strand, 12897876 - 12897795
Alignment:
| Q |
167 |
atgaaccacagattccatgtgttgatttgagtgcatcctgacaggtcacaaaatataagagactccaatcctggatcgtttg |
248 |
Q |
| |
|
||||||||||| ||| |||| |||||||| |||||||| || ||||| ||| | |||| ||||||||||||||||| |||| |
|
|
| T |
12897876 |
atgaaccacaggttcgatgtattgatttgtgtgcatcccgaaaggtccaaaactgtaagtgactccaatcctggatcatttg |
12897795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University