View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21513_low_47 (Length: 237)
Name: NF21513_low_47
Description: NF21513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21513_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 55 - 220
Target Start/End: Complemental strand, 41692660 - 41692495
Alignment:
| Q |
55 |
taaagaagttgcttaagaatagtatgtgacatgtgagatgtggaaagagagaataaaactagtatgggatccacacatttttggggttttctccaaattg |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41692660 |
taaagaagttgcttaagaatagtatgtgacatgtgagatgtggaaagagagaataaaactagtatgggatccacacatttttggggttttgtccaaattg |
41692561 |
T |
 |
| Q |
155 |
agggtgaatatttctatttgagccctagcacttcaatcataatcaaattgtctgaagggggcatat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
41692560 |
agggtgaatatttctatttgagccctagcacttcaatcataatcaaattgtctggaaggggcatat |
41692495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University