View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21514_high_6 (Length: 319)
Name: NF21514_high_6
Description: NF21514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21514_high_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 235 - 298
Target Start/End: Complemental strand, 4182285 - 4182222
Alignment:
| Q |
235 |
caaatgattggctggtacaaaaatattaacattcttatattatggttgtattttcataatacat |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4182285 |
caaatgattggctggtacaaaaatattaacattcttatattatggttatattttcataatacat |
4182222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 235 - 298
Target Start/End: Complemental strand, 4743129 - 4743066
Alignment:
| Q |
235 |
caaatgattggctggtacaaaaatattaacattcttatattatggttgtattttcataatacat |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4743129 |
caaatgattggctggtacaaaaatattaacattcttatattatggttatattttcataatacat |
4743066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 114 - 175
Target Start/End: Complemental strand, 4182462 - 4182401
Alignment:
| Q |
114 |
atccctttctggtagttgcttggtaatggtttgtaccttgcagttttaccagttgtctcatt |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
4182462 |
atccctttctggtagttgcttggtaatggtttgtatcttgcagttttaacagttgtctcatt |
4182401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 114 - 175
Target Start/End: Complemental strand, 4743306 - 4743245
Alignment:
| Q |
114 |
atccctttctggtagttgcttggtaatggtttgtaccttgcagttttaccagttgtctcatt |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
4743306 |
atccctttctggtagttgcttggtaatggtttgtatcttgcagttttaacagttgtctcatt |
4743245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 221
Target Start/End: Complemental strand, 4182375 - 4182334
Alignment:
| Q |
180 |
aaattactcaattcagcactgtttgtttctgctgctgcacta |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||| |||| |
|
|
| T |
4182375 |
aaattaatcaattcatcactgtttgtttctgctgctgtacta |
4182334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 221
Target Start/End: Complemental strand, 4743219 - 4743178
Alignment:
| Q |
180 |
aaattactcaattcagcactgtttgtttctgctgctgcacta |
221 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||| |||| |
|
|
| T |
4743219 |
aaattaatcaattcatcactgtttgtttctgctgctgtacta |
4743178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University