View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21514_low_10 (Length: 266)

Name: NF21514_low_10
Description: NF21514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21514_low_10
NF21514_low_10
[»] chr3 (1 HSPs)
chr3 (27-153)||(35757664-35757790)


Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 27 - 153
Target Start/End: Original strand, 35757664 - 35757790
Alignment:
27 atatgctcatgggatcgtctcattctgattttaccgaagcataattactacttgcttatattatgacaaatgatttatacaaactaaataacgaacaaat 126  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
35757664 atatgctcacgggatcgtctcattctgattttaccgaagcataattactacttgcttatattatgacaaatgatttatacaaactaaataacgaataaat 35757763  T
127 acgaagaattaattatgttgaaacata 153  Q
    |||||||||||||||||||||||||||    
35757764 acgaagaattaattatgttgaaacata 35757790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University