View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21514_low_10 (Length: 266)
Name: NF21514_low_10
Description: NF21514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21514_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 27 - 153
Target Start/End: Original strand, 35757664 - 35757790
Alignment:
| Q |
27 |
atatgctcatgggatcgtctcattctgattttaccgaagcataattactacttgcttatattatgacaaatgatttatacaaactaaataacgaacaaat |
126 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35757664 |
atatgctcacgggatcgtctcattctgattttaccgaagcataattactacttgcttatattatgacaaatgatttatacaaactaaataacgaataaat |
35757763 |
T |
 |
| Q |
127 |
acgaagaattaattatgttgaaacata |
153 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
35757764 |
acgaagaattaattatgttgaaacata |
35757790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University