View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21515_high_12 (Length: 252)
Name: NF21515_high_12
Description: NF21515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21515_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 13 - 233
Target Start/End: Original strand, 29776591 - 29776811
Alignment:
| Q |
13 |
aatatcaacaataaatgaattggctatgcagttagtaatcaggtctctgaaatgagtaccaattccaggtctagaagaggcaacggtaatacgaagggaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29776591 |
aatatcaacaataaatgaattggctatgcagttagtaatcaggtctctgaaatgagtaccaattccaggtctagaagaggcaacggtaatacgaagggaa |
29776690 |
T |
|
| Q |
113 |
tgattcttccatttcaaccattgacaatgacattccataatgtcaattattatgttgatatgccaaaggtgggaggatctttaattactaattccataaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29776691 |
tgattcttccatttcaaccattgacaatgacattccataatgtcaattattatgttgatatgccaaaggtgggaggatctttaattactaattccataaa |
29776790 |
T |
|
| Q |
213 |
atactttctatatatgcaaaa |
233 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29776791 |
atactttctatatatgcaaaa |
29776811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 106 - 183
Target Start/End: Complemental strand, 25523692 - 25523615
Alignment:
| Q |
106 |
aagggaatgattcttccatttcaaccattgacaatgacattccataatgtcaattattatgttgatatgccaaaggtg |
183 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
25523692 |
aagggaatgattcttccttttgaaccattgacaatgacattccacaatgtcaattattatgttgatatgccacaggtg |
25523615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University