View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21515_high_15 (Length: 237)
Name: NF21515_high_15
Description: NF21515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21515_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 23145057 - 23145269
Alignment:
| Q |
1 |
tctgtggttgcggcagtgctgaaaaaattaatcatctcttctttaattgtccggttttagcagtggtattgaacgagactttgaaatggcgtgggatcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23145057 |
tctgtggttgcggcagtgctgaaaaaattaatcatctcttctttaattgtccggttttagctgtggtattgaacgagactttgaaatggcgtgggatcca |
23145156 |
T |
|
| Q |
101 |
aactgccattttttatggaggttttaatgaccttaaacagttgaaagggctggtgataagtactaagaaggtgaaggatatattaggcttaatttgttga |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23145157 |
aactgccattttttatggaggttttgatgaccttaaacagttgaaagggctggtgttaagtactaagaaggtgaaggatatattaggcttaatttgttgc |
23145256 |
T |
|
| Q |
201 |
gcaaatatatcta |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
23145257 |
gcaaatatatcta |
23145269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University