View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21515_high_9 (Length: 298)
Name: NF21515_high_9
Description: NF21515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21515_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 288
Target Start/End: Original strand, 26536138 - 26536428
Alignment:
| Q |
1 |
atatctgctgaattcaatcacaatgaaaattttgatttgaatttccataaaacacaattaactaatgcgaatttgatgatttagtagtgatttatgtgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26536138 |
atatctgctgaattcaatcacaatgaaaattttgatttgaatttccataaaacacaattaactaatgcgaatttgatgatttagtagtgatttatgtgtg |
26536237 |
T |
 |
| Q |
101 |
ttaggtaagattaagaacatgattatg---nnnnnnnnnngcatgtatatgttaggtagttgtgatctggttttgatcgtttctatctgcatctgcatgt |
197 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26536238 |
ttaggtaagattaagaacatgattatgcttttttttttttgcatgtatatgttaggtagttgtgatctggttttgattgtttctatctgcatctgcatgt |
26536337 |
T |
 |
| Q |
198 |
gatgnnnnnnnaatggaagctaattcattgtcttgaaaattcaggttatgaatgatttgactgttttgtgaggtcataaaattggtctgtg |
288 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26536338 |
gatgtttttttaatggaagctaattcattgtcttgaaaattcaggttatgaatgatttgactgttttgtgaggtcataaaattggtctgtg |
26536428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University