View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21515_low_16 (Length: 241)
Name: NF21515_low_16
Description: NF21515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21515_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 230
Target Start/End: Original strand, 43953721 - 43953933
Alignment:
| Q |
18 |
gtatcaaattatgatattgagtgatcttgaagaaagatgtcgttaatggttttagcttttgtaatattgctgattttgtggatttctgattgatgatcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953721 |
gtatcaaattatgatattgagtgatcttgaagaaagatgtcgttaatggttttagcttttgtaatattgctgattttgtggatttctgattgatgatcaa |
43953820 |
T |
|
| Q |
118 |
attgtttatcgcatgttccccggtggtatacgatagctagaatgtagttccattctcccttgtctgcttgtttgttcatatacggtaactacgtttcaga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953821 |
attgtttatcgcatgttccccggtggtatacgatagctagaatgtggttccattctcccttgtctgcttgtttgttcatatacggtaactacgtttcaga |
43953920 |
T |
|
| Q |
218 |
tggttcatctcat |
230 |
Q |
| |
|
|||| ||| |||| |
|
|
| T |
43953921 |
tggtgcatatcat |
43953933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University