View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21516_low_16 (Length: 308)
Name: NF21516_low_16
Description: NF21516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21516_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 53 - 284
Target Start/End: Original strand, 2467797 - 2468028
Alignment:
| Q |
53 |
ctactcctcgctgcaatctcaaattaccaccacgctttcaattcaccaacatttttcgggctacaacggtaatttcctgaacctatcttcaacttcattt |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467797 |
ctactcctcgctgcaatctcaaattaccaccacgctttcaattcaccaacatttttcggtctacaacggtaatttcctgaacctatcttcaacttcattt |
2467896 |
T |
 |
| Q |
153 |
cattcaattcaatgcctcaaatttattttcattttcgtatagggattcgttcgtgcttccgaggatgactctgttgccgaaaattccgattctcaatgcc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467897 |
cattcaattcaatgcctcaaatttattttcattttcgtatagggattcgttcgtgcttccgaggatgactctgttgccgaaaattccgattctcaatgcc |
2467996 |
T |
 |
| Q |
253 |
aattggcaacacagaatgtgtcttctgatgat |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2467997 |
aattggcaacacagaatgtgtcttctgatgat |
2468028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University