View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21516_low_20 (Length: 238)
Name: NF21516_low_20
Description: NF21516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21516_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 12 - 220
Target Start/End: Original strand, 35485519 - 35485727
Alignment:
| Q |
12 |
caaaggcaaaaaaggatattagaagaaatccatgtaatttcttatatcttatttccatggtaattatggagaggtataaaacannnnnnnggtcttgacc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
35485519 |
caaaggcaaaaaaggatattagaagaaatccatgtaatttcttatatcttatttccattgtaattatggagaggtataaaacatttttttggtcttgacc |
35485618 |
T |
|
| Q |
112 |
ttcaagatgttgcctctctttttgtcaagaaccaaacctctaaccatgtagcttggattaaaactccaattcagaagctgcggggaaaaaactttcattt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
35485619 |
ttcaagatgttgcctctctttttgtcaagaaccaaacctctaaccatgtagcttggattaaaactccaattcagtagctgcggggaaaaaaatttcattt |
35485718 |
T |
|
| Q |
212 |
agcgaaaat |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
35485719 |
agcgaaaat |
35485727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 104 - 161
Target Start/End: Complemental strand, 6984187 - 6984130
Alignment:
| Q |
104 |
tcttgaccttcaagatgttgcctctctttttgtcaagaaccaaacctctaaccatgta |
161 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
6984187 |
tctttaccttcaagatgttgcctctctttttgtctagaaccaaccctctaaccatgta |
6984130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University