View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21516_low_23 (Length: 222)
Name: NF21516_low_23
Description: NF21516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21516_low_23 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 51823671 - 51823467
Alignment:
| Q |
18 |
cacctttaccaatccaaaattcattcccctttgagatgatttcactataatctttatcttaggaatttgagctctttaccttttttgtattgtttttcca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51823671 |
cacctttaccaatccaaaattcattcccctttgagatgatttcactataatctttatctttagtatttgagctctttcccttttttgtattgtttttcca |
51823572 |
T |
 |
| Q |
118 |
ctttgcaaaggttgtttttcagccttccatggtttcctcttcaattgcaccaactataaagtaaaagggagcaaaacataattgagaacttactaactaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51823571 |
ctttgcaaaggttgtttttcagccttccatggtttcctcttcaattgcaccatctgtaaagtaaaagggagcaaaacataattgagaactaactaactaa |
51823472 |
T |
 |
| Q |
218 |
cttta |
222 |
Q |
| |
|
||||| |
|
|
| T |
51823471 |
cttta |
51823467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University