View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21517_high_8 (Length: 276)
Name: NF21517_high_8
Description: NF21517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21517_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 275
Target Start/End: Complemental strand, 21175483 - 21175222
Alignment:
| Q |
13 |
tcatcactcagg-caacatggacagtgatcacgaaatcaaggaagctctaagtatgtaccttacactttagtactataattcagttcttcttcnnnnnnn |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
21175483 |
tcatcactcagggcaacatggacagtgatcacgaaatcaaggaagctctaagtatgtaccttacacttcattactataat-cagttcttcttctttttt- |
21175386 |
T |
 |
| Q |
112 |
cacagaaaaaatataacacgttttgttttactaatccgttgactttcagttaaaaactccgacgcaaccagatccaacggcgagaattctccgatcgaac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21175385 |
cacagaaaaaatataacacgttttgttttactaatccgttgactttcagttaaaaactccgacgcaaccagatccaacggcgagaattctccgatcgaac |
21175286 |
T |
 |
| Q |
212 |
aagtagccttaacagttccggtgaccgacgacccatcgcttccggtgtttactttcagaacatg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21175285 |
aagtagccttaacagttccggtgaccgacgatccatcgcttccggtgtttactttcagaacatg |
21175222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University