View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21517_low_6 (Length: 293)

Name: NF21517_low_6
Description: NF21517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21517_low_6
NF21517_low_6
[»] chr7 (2 HSPs)
chr7 (92-278)||(38177190-38177376)
chr7 (96-267)||(42414256-42414428)
[»] chr2 (3 HSPs)
chr2 (2-267)||(18978141-18978405)
chr2 (65-151)||(34211722-34211808)
chr2 (218-267)||(34211875-34211924)
[»] scaffold0094 (1 HSPs)
scaffold0094 (96-267)||(14214-14385)
[»] chr8 (1 HSPs)
chr8 (195-267)||(8619277-8619349)


Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 92 - 278
Target Start/End: Complemental strand, 38177376 - 38177190
Alignment:
92 aaattggaattgggatttgattgcagccatttttaatgaacaagataggaaggctatatccaaactggtgctgttgcatcgagatagagaggacaagcgc 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38177376 aaattggaattgggatttgattgcagccatttttaatgaacaagataggaaggctatatccaaactggtgctgttgcatcgagatagagaggacaagcgc 38177277  T
192 atatggaaatttaatagtcagggagtttatacggtaaagtccgcatatagatatgccatggaaacacttgttgatagtgaagaatat 278  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38177276 atatggaaatttaatagtcagggagtttatacggtaaagtccgcatatagatatgccatggaaacacttgttgatagtgaagaatat 38177190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 96 - 267
Target Start/End: Original strand, 42414256 - 42414428
Alignment:
96 tggaattgggatttgattgcagccatttttaatgaacaagataggaaggctatatccaaactggtgctgttgcatcgagatagagaggacaagcgcatat 195  Q
    |||||||||||  |||||||||  ||||| ||||| |||||| |  ||||| |||| ||| |||||||| || | |||||||| || || |||| ||| |    
42414256 tggaattgggagctgattgcaggaattttcaatgagcaagatcgagaggctgtatcaaaattggtgctgctgaaccgagatagggatgataagctcatct 42414355  T
196 ggaaatttaatagtcagggagtttatacggtaaagtccgcatatagat-atgccatggaaacacttgttgata 267  Q
    |||| || |||| ||| |||   || || ||||| || || ||||| | |||| |||||||||||||||||||    
42414356 ggaagttcaataatcaaggaaactacacagtaaaatcggcctataggtaatgctatggaaacacttgttgata 42414428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 2 - 267
Target Start/End: Complemental strand, 18978405 - 18978141
Alignment:
2 gtggctgagggaggatgaaaattcgtatgtctctagtgaaaaaattcaaggcatggaaagaatgaaggtagcagatttgatgagtggagaaaattggaat 101  Q
    |||||| ||||| ||||| |||||||||||  | || |||||| | |||||  ||||||  |||||||| ||||||||||||||||||||||  ||||||    
18978405 gtggctaagggaagatgagaattcgtatgttacaagcgaaaaa-tccaaggtttggaaaatatgaaggttgcagatttgatgagtggagaaagctggaat 18978307  T
102 tgggatttgattgcagccatttttaatgaacaagataggaaggctatatccaaactggtgctgttgcatcgagatagagaggacaagcgcatatggaaat 201  Q
    ||||   |||| ||||  ||||||||||| || || ||||| || ||||| ||  | |   |  || | || ||| | || || | || ||| ||||| |    
18978306 tgggggatgatagcagggatttttaatgatcatgacaggaaagcgatatctaatttagcattactgaaccgggatggggaagataggctcatttggaagt 18978207  T
202 ttaatagtcagggagtttatacggtaaagtccgcatatagatatgccatggaaacacttgttgata 267  Q
    ||||| |||| |||  ||||||||||| ||| |||||||||||||| |||||||||||||| ||||    
18978206 ttaatcgtcatggaaattatacggtaaggtcggcatatagatatgcaatggaaacacttgtggata 18978141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 65 - 151
Target Start/End: Original strand, 34211722 - 34211808
Alignment:
65 gaaggtagcagatttgatgagtggagaaaattggaattgggatttgattgcagccatttttaatgaacaagataggaaggctatatc 151  Q
    |||||| ||||||||||||||||||||||  ||||||||||   |||| ||||  ||||||||||| || |||||||| || |||||    
34211722 gaaggttgcagatttgatgagtggagaaagctggaattgggggatgatagcagggatttttaatgatcatgataggaaagcgatatc 34211808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 218 - 267
Target Start/End: Original strand, 34211875 - 34211924
Alignment:
218 ttatacggtaaagtccgcatatagatatgccatggaaacacttgttgata 267  Q
    ||||||||||| ||| |||||||||||||| |||||||||||||| ||||    
34211875 ttatacggtaaggtcggcatatagatatgcaatggaaacacttgtggata 34211924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0094 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0094
Description:

Target: scaffold0094; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 96 - 267
Target Start/End: Original strand, 14214 - 14385
Alignment:
96 tggaattgggatttgattgcagccatttttaatgaacaagataggaaggctatatccaaactggtgctgttgcatcgagatagagaggacaagcgcatat 195  Q
    ||||||||| |  |||||||||  ||||| ||||| |||||| |  |||||||||| ||| |||||||| || | |||||||| || || |||| ||| |    
14214 tggaattggaagctgattgcaggaattttcaatgagcaagatcgagaggctatatcgaaattggtgctgctgaaccgagatagggatgataagctcatct 14313  T
196 ggaaatttaatagtcagggagtttatacggtaaagtccgcatatagatatgccatggaaacacttgttgata 267  Q
    |||| || |||| ||| |||   || || ||||| || || ||||| ||||| |||||||||||||||||||    
14314 ggaagttcaataatcaaggaaactacacagtaaaatcggcctataggtatgctatggaaacacttgttgata 14385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 195 - 267
Target Start/End: Complemental strand, 8619349 - 8619277
Alignment:
195 tggaaatttaatagtcagggagtttatacggtaaagtccgcatatagatatgccatggaaacacttgttgata 267  Q
    ||||| |||||| |||| | | |||||||||||| ||| |||||||||||||| ||| |||||||||| ||||    
8619349 tggaagtttaatcgtcatgaaatttatacggtaaggtcggcatatagatatgcaatgaaaacacttgtggata 8619277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University