View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21517_low_9 (Length: 270)
Name: NF21517_low_9
Description: NF21517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21517_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 8 - 263
Target Start/End: Complemental strand, 22021315 - 22021053
Alignment:
| Q |
8 |
tgtatttgttgaattacaaatctcaactgaaacacattcttaacttgcctcatattgtgctgaaattttcgaaggatatgacgatactattgtcatggtg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22021315 |
tgtatttgttgaattacaaatctcaactgaaacacattcttaacttgtctcatattgtgctgaaattttcgaaggatatgatgatactattgtcatggtg |
22021216 |
T |
|
| Q |
108 |
tcttgcatgaaataatatgcctatctaaaataacaaaatatacg-tttgataataaattcagaaacaatagtacgtcctagaggtgtaaatacacgtatt |
206 |
Q |
| |
|
| |||||| |||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22021215 |
ttttgcataaaataatatgcctatctaaaataaaaaaatatacgttttgataataaattcagaaacaatagtacgtcctagaggtgtaaatacacgtatc |
22021116 |
T |
|
| Q |
207 |
catacttta------tttgatgatattacgatatttttcaaaggcactagaaagattgttcat |
263 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22021115 |
catactttattttcctttgatgatattacgatatttttcaaaggcactagaaagattgttcat |
22021053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University