View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21518_high_4 (Length: 236)
Name: NF21518_high_4
Description: NF21518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21518_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 39004232 - 39004012
Alignment:
| Q |
1 |
attcaaggataaattttgtgataagaaataatagaattaatgttgcacaagatctttgtttttatgaatggtctggagaatttggttggccaccttccac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39004232 |
attcaaggataaattttgtgataagaaataatagaattaatgttgcacaagatctttgtttttatgaatggtctggagaatttggttggccaccttccac |
39004133 |
T |
 |
| Q |
101 |
aaagtctctccttccaactatannnnnnncgttaacaaaccttgtagtcaaaatcttatttaaggaatttaagtctcgttcattcagccaatctaatatt |
200 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
39004132 |
gaagtctctccttccaaccatatttttttcgttaacaaaccttgtagtcaaaaccttatttaaggaattcaagtctggttcattcagccaatctaatatt |
39004033 |
T |
 |
| Q |
201 |
ggttgacgtctttataataat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39004032 |
ggttgacgtctttataataat |
39004012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University