View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21518_low_5 (Length: 243)
Name: NF21518_low_5
Description: NF21518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21518_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 2367862 - 2368085
Alignment:
| Q |
1 |
ttagaacatagattctcttatgnnnnnnnnaagatatcttttacaaaaagcagaatataacagtcttaagtttcaa-tgtaagataaaaatataccaatt |
99 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| ||||||||| || |||||||||||||||||||| |
|
|
| T |
2367862 |
ttagaacatagattctcttatgttttttttaagatatcttttgcaaaaagcagaatataacagtct-aagtttcaaatggaagataaaaatataccaatt |
2367960 |
T |
 |
| Q |
100 |
atgcttgcaaaaaagaattaaatatatagacatagatacatattcttccctcnnnnnnnnnngacatggatacatattccatattgttgcgtggaaacaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2367961 |
atgcttgcaaaaaagaattaaatatatagacatagatacatattcttccctcaaaaaaaaaagacatagatacatattccatattgttgcgtggaaacaa |
2368060 |
T |
 |
| Q |
200 |
cgtgtgctttttcaaaattgtgaaa |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2368061 |
cgtgtgctttttcaaaattgtgaaa |
2368085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 228
Target Start/End: Original strand, 2363716 - 2363758
Alignment:
| Q |
186 |
ttgcgtggaaacaacgtgtgctttttcaaaattgtgaaatgat |
228 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
2363716 |
ttgcgtagaaacaacgtgtgctttttcataattgagaaatgat |
2363758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University