View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21521_high_18 (Length: 237)
Name: NF21521_high_18
Description: NF21521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21521_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 35525987 - 35526110
Alignment:
| Q |
1 |
atgcattgcaatcactatagctctattaatgcacttgaagcattatgccccgtgctatcatgttgtttgaaatgaaaaatataaaggatactggattgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35525987 |
atgcattgcaatcactatagctctattaatgcacttgaagcattatgccccgtgctatcatgttatttgaaatgaaaaatataaaggatactggattgag |
35526086 |
T |
 |
| Q |
101 |
gcttcattttggtctgcagatcca |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35526087 |
gcttcattttggtctgcagatcca |
35526110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 193 - 221
Target Start/End: Original strand, 35526179 - 35526207
Alignment:
| Q |
193 |
aagaacaattgttctaaaagactggaacc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35526179 |
aagaacaattgttctaaaagactggaacc |
35526207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University