View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21521_high_19 (Length: 235)
Name: NF21521_high_19
Description: NF21521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21521_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 32240400 - 32240630
Alignment:
| Q |
1 |
actataaattttacttcatttgctggaaatttctggtttagggtatatgtggtttctgcaaaaggtaattaccatgtgtcaggaagtttgaaactattgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32240400 |
actataaattttacttcatttgctggaaatttctggtttagggtatatgtggtttctgcaaaaggtaattaccatgtgtcaggaagtttgaaactattgg |
32240499 |
T |
 |
| Q |
101 |
caatgggtcagagatactgatttttcccttcttttcttttaattgattctgacactgcgtgtataaaagatgaaattcata--tgccctttttctctata |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32240500 |
caatgggtcagagatactgatttttcccttcttttcttttaattgattctgacactgcgtgtataaaagatgaaattcatatgtgccctttttctctata |
32240599 |
T |
 |
| Q |
199 |
aaatggtgcttgctgtgttcatttcatctca |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32240600 |
aaatggtgcttgctgtgttcatttcatctca |
32240630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University